TiggerToo
Well-known member
what's the cost to you?
PC plotter software and chart recommendations
- Thread starter jimi
- Start date
DJE
Well-known member
Looks good doesn't it. But is it worth £550?
westernman
Well-known member
Do you have it connected to an autopilot?
claymore
Well-known member
No - it is connected to a Digital Yacht AIS/GPS thingie.
To be honest its is so simple to set the course and then look at the predictor line - once we are heading along that I just press the button on the autopilot (raymarine) - I've never thought it necessary to connect the two directly
claymore
Well-known member
Well - I don't remember the cost when I bought it - being a tight wad, I must have thought it ok!
I upgraded the charts last year which cost around £200 I think.
I don't think I really needed to do this so I'm blaming lockdown! The rocks are all in the same places and I've grazed a fair few of them over the years but I was planning to go to pastures new.
I had a discussion about using Antares charts but I was put off when someone said they may bugger up the laptop if they were loaded on as well as TimeZero.
bitbaltic
Well-known member
If you have a navionics chart card for your plotter you can upload the charts to your PC using software called PC plotter which I am surprised has not been mentioned. No extra cost on your navionics licence which allows (I think) five separate software installs; this is one reason it is expensive. PC plotter costs about 200 quid but there is no ongoing service charge and I’ve had my licence for it since 2015 and ported it from one machine to another - you just have to call them. The software supports all your NMEA data including AIS. It will also drive your autopilot.
I’ve also got a meridian Imray install so I have both navionics vector and imray raster on a 17-inch screen at the nav station.
The computer talks to a shipmodul multiplexer which sends all my NMEA (a mix of 0183 and N2K) to both charting packages and let’s both drive the autopilot.
If I don’t switch the computer on the multiplexer’s WiFi transmits also the entire NMEA bus to my phone and yes, the navionics app then displays AIS targets. Only a nice to have as the plotter does that anyway and it’s only a 30 ft boat.
So, raster and vector on the PC, AIS everywhere, AP control from both or either of the PC below or plotter up top.
Complete solutions are available
westernman
Well-known member
Thanks for your answer.
claymore
Well-known member
I left out that I'd probably bugger the whole shooting match up if I tried to connect them!
Yealm
Well-known member
If you have a navionics chart card for your plotter you can upload the charts to your PC using software called PC plotter which I am surprised has not been mentioned. No extra cost on your navionics licence which allows (I think) five separate software installs; this is one reason it is expensive. PC plotter costs about 200 quid but there is no ongoing service charge and I’ve had my licence for it since 2015 and ported it from one machine to another - you just have to call them. The software supports all your NMEA data including AIS. It will also drive your autopilot.
I’ve also got a meridian Imray install so I have both navionics vector and imray raster on a 17-inch screen at the nav station.
The computer talks to a shipmodul multiplexer which sends all my NMEA (a mix of 0183 and N2K) to both charting packages and let’s both drive the autopilot.
If I don’t switch the computer on the multiplexer’s WiFi transmits also the entire NMEA bus to my phone and yes, the navionics app then displays AIS targets. Only a nice to have as the plotter does that anyway and it’s only a 30 ft boat.
So, raster and vector on the PC, AIS everywhere, AP control from both or either of the PC below or plotter up top.
Complete solutions are available
Very interesting!
Thanks-do you know if the Navionics card is compatible with Garmin plotters?
Porthandbuoy
Well-known member
Anybody using a tablet from London Chartplotters?
I’m thinking of going down this route with the boat’s position, ais, wind, depth, etc. all accessible via Wi-fi.
Up till now I’ve been using an old netbook and VMH charts, but I’d like to get a display at the new boat’s helm.
I’m thinking of going down this route with the boat’s position, ais, wind, depth, etc. all accessible via Wi-fi.
Up till now I’ve been using an old netbook and VMH charts, but I’d like to get a display at the new boat’s helm.
KompetentKrew
Well-known member
If you search London Chartplotters on here you'll see that their customers are always very happy with them.
I wouldn't buy from them because they're selling a mix of cheap and secondhand tablets and I like to know exactly what I'm getting - London Chartplotters seem cagey about the model numbers, probably because if they were more explicit people would realise they could but the same thing cheaper elsewhere and install the software themselves. E,g. they currently have a 10" Samsung tablet which is £170 on their site, which I find is a 2015 model and can be found for £80 on eBay [archive link].
Clearly it's worth it for some people to pay for the software and charts to be loaded for them, and I daresay the owner of London Chartplotters is friendly and helpful when support is needed, but I'd rather buy a current model, install the software myself and be a bit more "futureproofed".
I've just noticed you said you want to be able to view the display at the help, @Porthandbuoy - I'm dubious if a cheap or older tablet will be viewable on a sunny day. I bought a £400 Samsung tablet last year with the latest AMOLED display and find it fine, but someone else on here complained that it was too dim. My B&G Vulcan is brighter though and IMO it's a proper chartpletter you want if you want to use it at the helm. it's guaranteed waterproof that way too, instead of being reliant on a plastic bag and the longevity of the tablet's battery.
I wouldn't buy from them because they're selling a mix of cheap and secondhand tablets and I like to know exactly what I'm getting - London Chartplotters seem cagey about the model numbers, probably because if they were more explicit people would realise they could but the same thing cheaper elsewhere and install the software themselves. E,g. they currently have a 10" Samsung tablet which is £170 on their site, which I find is a 2015 model and can be found for £80 on eBay [archive link].
Clearly it's worth it for some people to pay for the software and charts to be loaded for them, and I daresay the owner of London Chartplotters is friendly and helpful when support is needed, but I'd rather buy a current model, install the software myself and be a bit more "futureproofed".
I've just noticed you said you want to be able to view the display at the help, @Porthandbuoy - I'm dubious if a cheap or older tablet will be viewable on a sunny day. I bought a £400 Samsung tablet last year with the latest AMOLED display and find it fine, but someone else on here complained that it was too dim. My B&G Vulcan is brighter though and IMO it's a proper chartpletter you want if you want to use it at the helm. it's guaranteed waterproof that way too, instead of being reliant on a plastic bag and the longevity of the tablet's battery.
Zing
Well-known member
I like it the best. Snappy and clear. Does weather routing with GRIBS nicely. Integrates perfectly with the radar too. I have Open CPN, but rarely use it. I have INavX on the I-Things and CMap on an old Raymarine plotter. Third and fourth favourites.
Chi34
Member
TZ will synchronise and share routes and charts across PC onboard, Plotter onboard (Furuno), and a PC at home. Works very well.
iPad app syncs too.
Not a budget solution, but very comprehensive.
iPad app syncs too.
Not a budget solution, but very comprehensive.
Wing Mark
Well-known member
I think you're paying for a sorted unit that works out of the box.
So of the value is in their knowledge of what works well and the time they spend sourcing the hardware.
You might be able to buy the bare unit cheaper yourself, but that still takes some of your time, having someone sort it for you has a value.
Pay an IT bloke to set up a PC, it will cost you a few hours' wages.
For many boats 'at the helm' might mean viewing a tablet in the shade of a sprayhood?
dunedin
Well-known member
Do you know what source(s) does Time Zero use for tidal flow information, to use for route planning?
Mountaineer
New member
I have Navionics on my Raymarine plotter and VMH UKHO charts on a 10" Samsung tablet using Marine Navigator software plus I have Bob Bradfields Antares charts seamlessly integrated with the UKHO charts for west coast pilotage. I use the plotter for passage making and VMH set up for pilotage .VMH support is excellent and the Marine Navigator s/w is designed for sailors and easy to use.
londonchartplotters
Member
Tad unfair comparing the price of a non guaranteed tablet,with a licenced chart and app,fully checked guaranteed in house 6 months with best quality mains and decent 12v chargers plural and decent stand,antiglare,aftersales and support model,.If you take off the price of charts ,app and superb kit tgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgrtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtfgxxxtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgcxtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgffffffrrtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgwjwtgztgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtg3wtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgkmtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtg
Tad unfair and missleading compairing the price of a 2nd hand model on ebay with the price of a fully licenced charted and app,tested and 6 month guaranteed model,including top quality kit,of the correct type,eg goldplate usb,s,qc3 charger for home,waterproof 3 amp regulated for boat,holder that wont release the tablet etc etc..If you deduct the price of all the app charts and kit that you will need,probably buying the wrong kit, it paints a very different picture.on duty 7 days for live support badly thought out comments are very disheartening.The reason we have so many happy customers is that they seem to have worked out what you have missed completely.Steve
Poecheng
Well-known member
Steve supplied me with a chartplotter a few years ago and it was great, worked straight out of the box and is still good and all for a very modest price. I say out of the 'box' but it was personally delivered and explained to me. You won't find anyone more willing to help. Deserves support.
